Learn More
Thermo Scientific™ M13/pUC Sequencing Primer (-46), 22-mer
Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends.
Brand: Thermo Scientific™ SO114
19.64 GBP valid until 2024-11-30
Use promo code "21651" to get your promotional price.
Description
Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19 (Cat. No. SM0221), pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR
Primer Sequence: 5'-d(GCCAGGGTTTTCCCAGTCACGA)-3'
Specifications
Sequencing Primer | |
Dry Ice | |
M13 | |
pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II | |
Liquid |
M13/pUC Sequencing Primer (-46), 22-mer, 10 μM (45 μL) Store at –20°C. |
|
10 μM | |
45 μL | |
Sequencing |
For Research Use Only. Not for use in diagnostic procedures.