Invitrogen™ T7 Promoter Primer

Thermo Fisher Scientific offers primers for PCR amplification that complement many of the vectors currently available.

Brand:  Invitrogen™ N56002

Product Code. 11675591

Description

Thermo Fisher Scientific offers primers for PCR amplification that complement many of the vectors currently available. The T7 Promoter Primer is recognized by T7 RNA polymerase and is commonly used to regulate gene expression of recombinant proteins. Subsequent recombinant proteins may be used for further downstream research applications.

T7 Promoter Primer features include:
• Desalted and purified by gel filtration
• Assayed for function by PCR amplification
• Provided in 2 μg quantity

Applications
• Sanger sequencing
• PCR amplification

T7 Primer Sequence: 5´- TAATACGACTCACTATAGGG- 3´

Order Info

Shipping Conditions: Room Temperature

Specifications

• Promoter: T7
• Content And Storage: • T7 Promoter Primer (2 μg)
  
  Store in Freezer at –20°C.
  Guaranteed stable for 6 months when properly stored.
• Primer Sequence: 5 ́d[TAATACGACTCACTATAGGG]3 ́
• Shipping Condition: Room Temperature
• Quantity: 2 μg
• Form: Lyophilized

• Product Type: Primer
• Primer Length: 20-mer
• Purification Method: Gel-purified
• Primer: T7
• For Use With (Application): PCR Amplification

For Research Use Only. Not for use in diagnostic procedures.